DNA Profiling And Its Value In Establishing Guilt Or Innocence

Context: In mid-June, the Madras High Court set aside the conviction of a man accused of rape in a POCSO case.

More in News

• The prosecution did not prove the case beyond a reasonable doubt, leading to the conviction being overturned.
• The judgement questioned the sole reliance on DNA evidence to establish guilt.

What is DNA Profiling?

• DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from a person or sample of bodily tissue.
• Process of Profiling: The process includes isolating DNA, purifying it, measuring the amount, amplifying specific markers, and analysing the results.
• These patterns are unique to each individual (except identical twins) and are used to match DNA samples from crime scenes with suspects.

Concept of DNA Profiling

• DNA Structure:
  • DNA, or deoxyribonucleic acid, is the hereditary material in humans and other organisms.
  • It consists of sequences of four nucleotides: adenine (A), guanine (G), thymine (T), and cytosine (C).
  • These sequences form a unique genetic code for each individual.
• Short Tandem Repeats (STRs):
  • Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence.
    • For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times.
    • The number of times these sequences repeat varies among individuals, creating a unique DNA profile.
  • STRs are found in DNA at specific locations, known as loci.
• Loci Examination:
  • In forensic DNA profiling, specific loci are selected to create a DNA profile.
  • By comparing these loci, forensic scientists can determine whether two DNA samples match, helping to identify individuals and link them to crime scenes.

Issues related with DNA Profiling

• DNA analysis is based on probability, not certainty. It can strongly suggest but not definitively prove identity.
  • For example, a match might indicate that 1 in 100,000 people could have that DNA profile.
• Contamination of samples can occur if not handled properly, affecting the accuracy.
  • Delays or mistakes in collecting or testing samples can lead to inconclusive results.
• DNA evidence should be supported by other evidence. It is not enough to convict someone on DNA alone without other corroborating facts.

Legal Perspective

• According to the Law Commission of India’s report, a match does not conclusively prove identity but indicates a probability ratio.
• In Pattu Rajan v. State of T.N. 2019, the court acknowledged that the value of DNA evidence varies by case and should be supported by other evidence.
• DNA evidence, while increasingly accurate, is not infallible and should not solely determine guilt or innocence.

Sharing is caring!